Grading System for Student Marks

  Grading System for Student Marks: # Input marks obtained by the student marks = float(input("Enter the marks obtained by the student: ")) # Define the grading criteria if marks >= 80: grade = 'A' elif marks >= 60: grade = 'B' else: grade = 'C' # Display the grade print(f"The student scored {marks}%, hence gets Grade {grade}.") Printing Multiplication Tables: # Printing multiplication tables from 2 to 25 for i in range(2, 26): for j in range(1, 11): print(f"{i} x {j} = {i*j}") Finding Stop Codons in RNA Sequence: # Given RNA sequence rna_sequence = "AAGCGCUGGUAAAAAGAAUAGGAACGGAGCUGCUAAUUUAUAUGACGAUGAAAAUGCCAGAUGGUGUGG" # Define stop codons stop_codons = ["UAA", "UGA", "UAG"] # Find stop codons in the RNA sequence stop_codon_positions = [i for i in range(len(rna_sequence)-2) if rna_sequence[i:i+3] in stop_codons] # Display stop codon positions print("Stop codon positions:") for pos in stop_codon_positions: print(pos) Explanation of Provided Codes: 1. The first code segment takes the marks obtained by a student, then assigns a grade (A, B, or C) based on the grading criteria mentioned. 2. The second code segment prints multiplication tables from 2 to 25 in the specified format (e.g., 2 x 1 = 2). 3. The third code segment extracts and displays the positions of stop codons (UAA, UGA, UAG) in the given RNA sequence. Please note that the provided Python codes demonstrate the functionalities as per the outlined requirements.    

Sample Answer